Example Sequence:

       AGTTAGGGGCGATCTGAACTTTGTCAATAGGGCAAACCAGCGACTGAACCCCATGCACCAACTCTTGAGG
       CATTTCCAAAAAGATGCAAAA

      Organism:  Human

       Example Output:

       Telomeres in Human was found!

       Sequence Length : 91
       Start Position       :  3
       End Position         :  8
       Sequence             :  TTAGGG
       Number of
        telomeres            :  1




Contact: btistnau@gmail.com
Developed by: Archana. P, Senior Research Fellow

Home     Help     Back